View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304-Insertion-28 (Length: 140)
Name: NF4304-Insertion-28
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304-Insertion-28 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 6 - 140
Target Start/End: Complemental strand, 43629878 - 43629744
Alignment:
| Q |
6 |
gcttcaaaggcaggggttgagccatggttatggagagccatggttgactggtgacgttgactttggccgtgtgtttattatgggtgactcttctggcggg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43629878 |
gcttcaaaggcaggggttgagccatggttatggagagccatggttgactggtgacgttgactttggccgtgtgtttattatgggtgactcttctggcggg |
43629779 |
T |
 |
| Q |
106 |
aacattgcgcaccagcttgcggttcggtttggatc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43629778 |
aacattgcgcaccagcttgcggttcggtttggatc |
43629744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University