View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304-Insertion-3 (Length: 65)
Name: NF4304-Insertion-3
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304-Insertion-3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 46140885 - 46140821
Alignment:
| Q |
1 |
atatcgtcttgccccggaacaccgtcttccggcagcctatgaagactccgtggagattcttcact |
65 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46140885 |
atatcgtcttgcaccggaacaccgtcttccggcagcctatgaagactccgtggagattcttcact |
46140821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University