View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304-Insertion-6 (Length: 107)
Name: NF4304-Insertion-6
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 5e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 5 - 107
Target Start/End: Original strand, 30370099 - 30370201
Alignment:
| Q |
5 |
atatagaagtagttataaggtacaaaatgcatgattattgtttacataaagaacaaaatattacttcaccattatagcttatttagttctataaacattt |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30370099 |
atatagaagtagttgtaaggtacaaaatgcatgataattgtttacataaagaacaaaatattacttcaccattatagcttatttagttctataaacattt |
30370198 |
T |
|
| Q |
105 |
cat |
107 |
Q |
| |
|
||| |
|
|
| T |
30370199 |
cat |
30370201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University