View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4304_low_9 (Length: 243)
Name: NF4304_low_9
Description: NF4304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4304_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 77 - 229
Target Start/End: Complemental strand, 47822334 - 47822173
Alignment:
| Q |
77 |
attatacatattatattgttgaaagattcatttccaaatgtaattcaggttaatatatatgcatnnnnnnnnnnnnn----tgaacttataataagatgc |
172 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47822334 |
attatacatattatatttttgaaagattcatttccaaatgtaattcaggttaatatatatgcataaaaataaaataaaaaatgaacttataataagatgc |
47822235 |
T |
 |
| Q |
173 |
agaggaggtggtatgtatatga-----atataacaaaatgtcaacataagttgtcaaacttg |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47822234 |
agaggaggtggtatgtatatgatatccatataacaaaatgtcaacataagttgtcaaacttg |
47822173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University