View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4305_low_2 (Length: 247)
Name: NF4305_low_2
Description: NF4305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4305_low_2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 23 - 247
Target Start/End: Original strand, 5019781 - 5020013
Alignment:
| Q |
23 |
agctagttcatgaattttgagctatgattgtgagataaaaagatcgattctgtcctagt-------cagtactgtgggttgtaactatgtttacgtttga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
5019781 |
agctagttcatgaattttgagctatgattgtgagataaaaagatcgattctgtcctagtcagtagtcagtactgtgggttgtaactatctttacgtttga |
5019880 |
T |
 |
| Q |
116 |
ggcagacactactagggtatgcttctcttttttggttctttaattaggatttaggaagcataaagcctaaattatgcatctattgtgcac-aacagtacg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
5019881 |
ggcagacactactagggtatgcttctcttttttggttctttaattaggatttaggaagcataaagcctaaattatgcatctattgtgcacaaacagtatg |
5019980 |
T |
 |
| Q |
215 |
aggtgatgaacacatcagcaatactgatctaga |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5019981 |
aggtgatgaacacatcagcaatactgatctaga |
5020013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University