View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-100 (Length: 43)
Name: NF4306-Insertion-100
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-100 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 5 - 43
Target Start/End: Original strand, 23268515 - 23268553
Alignment:
| Q |
5 |
aatgtgagattgttttttaattgaagcaacaaagttcgt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23268515 |
aatgtgagattgttttttaattgaagcaacagagttcgt |
23268553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.0000000006; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.0000000006
Query Start/End: Original strand, 5 - 36
Target Start/End: Original strand, 3750045 - 3750076
Alignment:
| Q |
5 |
aatgtgagattgttttttaattgaagcaacaa |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3750045 |
aatgtgagattgttttttaattgaagcaacaa |
3750076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 43
Target Start/End: Original strand, 5614184 - 5614222
Alignment:
| Q |
5 |
aatgtgagattgttttttaattgaagcaacaaagttcgt |
43 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5614184 |
aatgcgagattgtttttgaattgaagcaacaaagttcgt |
5614222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 28; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 36
Target Start/End: Original strand, 5560102 - 5560133
Alignment:
| Q |
5 |
aatgtgagattgttttttaattgaagcaacaa |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
5560102 |
aatgtgagattgttttttaattgatgcaacaa |
5560133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University