View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-101 (Length: 129)
Name: NF4306-Insertion-101
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-101 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 2 - 129
Target Start/End: Complemental strand, 54264771 - 54264643
Alignment:
| Q |
2 |
ctagattacctaatagcgaaaaaaccatttaacaaataacaattgcaggatatttttgatgacgcaaaataaaatgctagttactctaagaaaaga-aaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54264771 |
ctagattacctaatagcgaaaaaaccatttaacaaataacaattgcaggatatttttgatgacgcaaaataaaatgctagttactctaagaaaagaaaaa |
54264672 |
T |
|
| Q |
101 |
actaggtcctactttttatctcttgagca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54264671 |
actaggtcctactttttatctcttgagca |
54264643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University