View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4306-Insertion-102 (Length: 49)

Name: NF4306-Insertion-102
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4306-Insertion-102
NF4306-Insertion-102
[»] chr5 (1 HSPs)
chr5 (7-48)||(26423690-26423731)


Alignment Details
Target: chr5 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 26423690 - 26423731
Alignment:
7 ctaggggtatttgtttttggtgtatttatcttttgttttctt 48  Q
    ||||||||||||||||||||||||||||||||||||||||||    
26423690 ctaggggtatttgtttttggtgtatttatcttttgttttctt 26423731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University