View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-102 (Length: 49)
Name: NF4306-Insertion-102
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-102 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 26423690 - 26423731
Alignment:
| Q |
7 |
ctaggggtatttgtttttggtgtatttatcttttgttttctt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26423690 |
ctaggggtatttgtttttggtgtatttatcttttgttttctt |
26423731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University