View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-104 (Length: 199)
Name: NF4306-Insertion-104
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-104 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-109
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 54288572 - 54288374
Alignment:
| Q |
1 |
gttccacggttatgggagatgataaacctgaacaagaaacttaggcaaatccattagaaatattcaacagtatgcaaatttagtgtacaaatgaggaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54288572 |
gttccacggttatgggagatgataaacctgaacaagaaacttaggcaaatccattagaaatattcaacagtatgcaaatttagtgtacaaatgaggaagg |
54288473 |
T |
|
| Q |
101 |
tgcggtgagtggtgaaggacctttgtcgccggcagtggctgttggtcggatgtgtagacagctgaaccatgaaatggatgccattcctttaagaaatta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54288472 |
tgcggtgagtggtgaaggacctttgtcgccggcagtggctgttggtcggatgtgtagacagctgaaccatgaaatggatgccattcctttaagaaatta |
54288374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University