View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-12 (Length: 157)
Name: NF4306-Insertion-12
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 41206351 - 41206504
Alignment:
| Q |
5 |
atttacaatttagcaaagaaagaatttatgttgtggtcatatgaaagaaacagtatctatatgtacccaaaa--agaagtagtgtaaatgtgatgggcac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41206351 |
atttacaatttagcaaagaaagaatttatgttgtggtcatatgaaagaaacagtatctatatgtacccaaaaaaagaagtagtgtaaatgtgatgggcac |
41206450 |
T |
 |
| Q |
103 |
agtgacaggcatggtaggagagaggccaagtctcatgagactctgagtatcaaa |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41206451 |
agtgacaggcatggtaggagagaggccaagtctcatgagactctgagtatcaaa |
41206504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University