View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-13 (Length: 45)
Name: NF4306-Insertion-13
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 31; Significance: 0.000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.000000003
Query Start/End: Original strand, 11 - 41
Target Start/End: Original strand, 41261780 - 41261810
Alignment:
| Q |
11 |
gtctctaccaactgagctaaacttacgtgga |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41261780 |
gtctctaccaactgagctaaacttacgtgga |
41261810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 11 - 42
Target Start/End: Complemental strand, 8174295 - 8174264
Alignment:
| Q |
11 |
gtctctaccaactgagctaaacttacgtggac |
42 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
8174295 |
gtctctaccaactgagctaaacttacgaggac |
8174264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 28; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 12 - 43
Target Start/End: Original strand, 12036947 - 12036978
Alignment:
| Q |
12 |
tctctaccaactgagctaaacttacgtggaca |
43 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
12036947 |
tctctaccaactgagctaaactaacgtggaca |
12036978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University