View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-14 (Length: 155)
Name: NF4306-Insertion-14
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 7e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 7e-66
Query Start/End: Original strand, 5 - 155
Target Start/End: Original strand, 45831211 - 45831361
Alignment:
| Q |
5 |
accatcttcatagttttaatagaaagaggtaatttggttttttagtaggaattagcgaaagttttctatggttctatttttatgcagcttgaacgaaaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45831211 |
accatcttcatagttttaatagaaagaggtaatttggttttttagtgggaattggcgaaagttttctatggttctatttttatgcagcttgaaagaaaaa |
45831310 |
T |
 |
| Q |
105 |
tctacgattagaagatatacgaagaattatatcatacttttaaggctttgt |
155 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45831311 |
gctacaattagaagatatacgaagagttatatcatacttttaaggctttgt |
45831361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 43857232 - 43857289
Alignment:
| Q |
30 |
gaggtaatttggttttttagtaggaattagcgaaagttttctatggttctatttttat |
87 |
Q |
| |
|
|||||||||||| |||| |||||||||| | |||||||||||| | |||| ||||||| |
|
|
| T |
43857232 |
gaggtaatttggattttcagtaggaattggtgaaagttttctaggattctctttttat |
43857289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University