View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-18 (Length: 145)
Name: NF4306-Insertion-18
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 5 - 145
Target Start/End: Original strand, 8402416 - 8402556
Alignment:
| Q |
5 |
atgatgtggatgtgttctggaaacaaggatggtggaagggccacataaaggaagatttagggtatggaaagtttagggtgactgtaactggcactcctac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8402416 |
atgatgtggatgtgttctggaaacaaggatggtggaagggccacataaaggaagatttagggtatggaaagtttagggtgactgtaactggcactcctac |
8402515 |
T |
|
| Q |
105 |
gaaagtgttttcaaagaagaagcttaggattcatagtaatt |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
8402516 |
gaaagtgttttcaaaggaaaagcttaggattcatcgtaatt |
8402556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 89; Significance: 3e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 7 - 143
Target Start/End: Original strand, 5475536 - 5475672
Alignment:
| Q |
7 |
gatgtggatgtgttctggaaacaaggatggtggaagggccacataaaggaagatttagggtatggaaagtttagggtgactgtaactggcactcctacga |
106 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||| | |||| |||||||| ||||| |
|
|
| T |
5475536 |
gatgtggatgtgttctggaaacaagggtggtggaagggctacgtaaaggaagatttagggtatggaaagtttagggttagtgtatctggcactaatacga |
5475635 |
T |
|
| Q |
107 |
aagtgttttcaaagaagaagcttaggattcatagtaa |
143 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||||| |||| |
|
|
| T |
5475636 |
aagtgttttcaaaggagaagctgagggttcatcgtaa |
5475672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University