View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-21 (Length: 150)
Name: NF4306-Insertion-21
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 6e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 12909093 - 12909173
Alignment:
| Q |
1 |
ataaatgcacataatggcggtgtttggaataacagatagcttgcaccacattgttgaacagtcaactttttctggtccatg |
81 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12909093 |
ataaatgcacataatggaggtgtttcgaataacagatggattgcaccacattgttgaacagtcaactttttctggtccatg |
12909173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 77 - 136
Target Start/End: Original strand, 12909203 - 12909262
Alignment:
| Q |
77 |
ccatgtgtcattattttttgaatgtcccaatatgattattatgtatagacacaaattaag |
136 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
12909203 |
ccatgtgtcattattttttgaatgtcacaatatgataattatgtatagacacaaattaag |
12909262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.0000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 86 - 134
Target Start/End: Complemental strand, 7696320 - 7696272
Alignment:
| Q |
86 |
attattttttgaatgtcccaatatgattattatgtatagacacaaatta |
134 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
7696320 |
attatttttttaatgtcccaatgtgatgattatgtatggacacaaatta |
7696272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University