View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-22 (Length: 219)
Name: NF4306-Insertion-22
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 219
Target Start/End: Complemental strand, 39784789 - 39784574
Alignment:
| Q |
5 |
atataccacttcgttttctgtgtctttaaagggaaaaaa-gaatcttaaattcttacataacagttttgttttgtttaatctccaacagtatataatagc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784789 |
atataccacttcgttttctgtgtctttaaagggaaaaaaagaatcttaaattcttacataacagttttgttttgtttaatctccaacagtatataatagc |
39784690 |
T |
|
| Q |
104 |
cagagcttgatggggaatgtgagagcatattagcagagttttcatcaaattttaaaaaggttgtccctcaagnnnnnnngaaaagattaaggaagagttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39784689 |
cagagcttgatggggaatgtgagagcatattagcagagttttcatcaaattttaaaaaggttgtccctcaagtttttttgaaaagattaaggaagagttt |
39784590 |
T |
|
| Q |
204 |
cttgctttttcttcag |
219 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39784589 |
cttgctttttcttcag |
39784574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University