View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-25 (Length: 94)
Name: NF4306-Insertion-25
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 12722980 - 12723073
Alignment:
| Q |
1 |
atttcttctccaaatatgagttgtggagaggtaggaaattcaattggaggaggtgannnnnnngtgactatagttgtgactttggaataatatt |
94 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12722980 |
atttcttctccaaatatgagttgtggtgaggtaggaaattcaattggaggaggtgatttttttgtgactatagttgtgactttggaataatatt |
12723073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University