View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-31 (Length: 45)
Name: NF4306-Insertion-31
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-31 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 1e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 52471953 - 52471997
Alignment:
| Q |
1 |
gttggaactggaagctaggaggaatgaacttatgtcccgtgaaat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471953 |
gttggaactggaagctaggaggaatgaacttatgtcccgtgaaat |
52471997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.000000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 3 - 42
Target Start/End: Original strand, 40751074 - 40751113
Alignment:
| Q |
3 |
tggaactggaagctaggaggaatgaacttatgtcccgtga |
42 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40751074 |
tggaactggaagctcggaggaatgaacttatgtcccgtga |
40751113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.00000004
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 41476826 - 41476866
Alignment:
| Q |
4 |
ggaactggaagctaggaggaatgaacttatgtcccgtgaaa |
44 |
Q |
| |
|
|||||||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
41476826 |
ggaactggaaactcggaggaatgaacttaagtcccgtgaaa |
41476866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University