View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-33 (Length: 153)
Name: NF4306-Insertion-33
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-33 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 6 - 153
Target Start/End: Original strand, 45108850 - 45108990
Alignment:
| Q |
6 |
gaaggtaatgtaactaaa-tatgctaaataaattcagtttataaaaggaagatacaatatagtacagacaaacataaacattaaagcatgcatcttttgc |
104 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45108850 |
gaaggtaatgtaactaaaatatgctaaat----tcagtttataaaaggaagataaaatatagtacagacaaacataaacattaaagcat----cttttgc |
45108941 |
T |
|
| Q |
105 |
atttagacttgtcacagctaatgttgaagttatccttgtcttgtggaag |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108942 |
atttagacttgtcacagctaatgttgaagttatccttgtcttgtggaag |
45108990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University