View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-36 (Length: 254)
Name: NF4306-Insertion-36
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-36 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 143 - 254
Target Start/End: Original strand, 37466258 - 37466369
Alignment:
| Q |
143 |
tcggaaaccaacagtgaggtaatcttcgggtctgggataggtggagacaatagcagaagaagcagcctttgacggagtctcctcagccgctttagcttca |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37466258 |
tcggaaaccaacagtgaggtaatcttcgggtctgggataggtggagacaatagcagaagaagcagcctttgacggagtctcctcagccgctttagcttca |
37466357 |
T |
|
| Q |
243 |
gcatcaaccaca |
254 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37466358 |
gcatcaaccaca |
37466369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 37466117 - 37466200
Alignment:
| Q |
1 |
attattaaattaaatttcttcattgaatcaaaatttcagcgccccattttccaatcaaattaaaacatgacattcagaatcgag |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37466117 |
attattaaattaaatttcttcattgaatcaaaatttcagcgccccattttccaatcaaattaaaacgtgacattcagaatcgag |
37466200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University