View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-39 (Length: 121)
Name: NF4306-Insertion-39
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-39 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 6e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 6 - 121
Target Start/End: Complemental strand, 45222303 - 45222189
Alignment:
| Q |
6 |
catcaatctcacacgtcttttgtcttttttattattggctaccattcttaagagtggttatcaacccaatttggtcacttttaatacaattatcaatggt |
105 |
Q |
| |
|
||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45222303 |
catcaatctcacacggcttttg-ctttttcattattggctaccattcttaagagtggttatcaacccaatttggtcacttttaatacaattatcaatggt |
45222205 |
T |
 |
| Q |
106 |
ttttgtatcaatggta |
121 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45222204 |
ttttgtatcaatggta |
45222189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University