View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-40 (Length: 99)
Name: NF4306-Insertion-40
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-40 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 5e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 14970407 - 14970309
Alignment:
| Q |
1 |
gtatatcttttctattggcaggtggttatttttccaggaattttttccatttctatatttctaatcatagttgcctatgctcgcaaaaaggggttgatt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14970407 |
gtatatcttttctattggcaggtggttatttttccaggatttttttccatttctatatttctaatcatagttgcctatgctcgcaaaaaggggttgatt |
14970309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 14987504 - 14987423
Alignment:
| Q |
8 |
ttttctattggcaggtggttatttttccaggaattttttccatttctatatttctaatcatagttgcctatgctcgcaaaaa |
89 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||| ||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
14987504 |
ttttttattggcaggtggttatttttacaggaattttttccatatctatatttctcaccatagttgcctctgctcgcaaaaa |
14987423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University