View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-46 (Length: 91)
Name: NF4306-Insertion-46
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-46 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 29205996 - 29206086
Alignment:
| Q |
1 |
aggtttgggtctcatttttagaggggacaacatgacgcgtgcccgtgaagggacgaaattgtcttccaaaggatagggaagctccattaga |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29205996 |
aggtttgggtctcatttttagaggggacaacatgacgcgtgcccgtgaagggacgaaattgtcttccgaaggatagggaagctccattaga |
29206086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 4e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 12645879 - 12645789
Alignment:
| Q |
1 |
aggtttgggtctcatttttagaggggacaacatgacgcgtgcccgtgaagggacgaaattgtcttccaaaggatagggaagctccattaga |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
12645879 |
aggtttgggtctcatttttagaggggacaacatgacgcttgcccgtgaagggaggaaattgtcttccgaacgatagggaagctccattaga |
12645789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University