View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-50 (Length: 87)
Name: NF4306-Insertion-50
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 51; Significance: 7e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 7e-21
Query Start/End: Original strand, 2 - 64
Target Start/End: Complemental strand, 304533 - 304471
Alignment:
| Q |
2 |
gttgttgtgttggaaattgtctgactaattctactagatttctgctcttcctccagcacaaaa |
64 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
304533 |
gttgttatgttggaaattgtctgactaattctactagatttctgctcttcccccatcacaaaa |
304471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 81
Target Start/End: Original strand, 13798497 - 13798539
Alignment:
| Q |
38 |
gatttctgctcttcctccagcacaaaaacactcgcgctctgcag |
81 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
13798497 |
gatttctgctcttcccccagcac-aaaacactcgcgccctgcag |
13798539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University