View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-52 (Length: 58)
Name: NF4306-Insertion-52
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 52
Target Start/End: Original strand, 2943078 - 2943124
Alignment:
| Q |
6 |
gttatcactttcggtgtctatataagggtgactcaactactaaaaaa |
52 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2943078 |
gttatcactctcgacgtctatataagggtgactcaactactaaaaaa |
2943124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University