View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-53 (Length: 58)
Name: NF4306-Insertion-53
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 54012042 - 54012076
Alignment:
| Q |
1 |
agatggtccaccattctaatcagttatgatgtact |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012042 |
agatggtccaccattctaatcagttatgatgtact |
54012076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University