View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-56 (Length: 78)
Name: NF4306-Insertion-56
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-56 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 5e-37
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 14060240 - 14060163
Alignment:
| Q |
1 |
aatacaaccttaaaccaagaagatgatgacgatgaagaagttcttagttgtaattggaatacttataaaagcataagg |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14060240 |
aatacaaccttaaaccaagaagatgatgacgatgaagaagttcttagttgtaattggaatacttataaaagcataagg |
14060163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 14048869 - 14048792
Alignment:
| Q |
1 |
aatacaaccttaaaccaagaagatgatgacgatgaagaagttcttagttgtaattggaatacttataaaagcataagg |
78 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
14048869 |
aatacaaccttaaaccaagaagatgatgatgatgaagaagttcttagttgttaatggaatacttataaaagcataagg |
14048792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University