View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-58 (Length: 117)
Name: NF4306-Insertion-58
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-58 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 3e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 54154876 - 54154760
Alignment:
| Q |
1 |
ttttagagggtaaagtgcagcaataaccattgcttaaaaatctaatagctgagaagcataaatataacaacatgtgtaattttgtatgataaactaaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
54154876 |
ttttagagggtaaagtgcagcaataaccattgcttaaaaatctaatagctgagaagcataaatattaaaacatgtgtaattttgtatgataaactaaaag |
54154777 |
T |
|
| Q |
101 |
gttgtgacatggttttc |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
54154776 |
gttgtgacatggttttc |
54154760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000009
Query Start/End: Original strand, 2 - 40
Target Start/End: Complemental strand, 54128884 - 54128846
Alignment:
| Q |
2 |
tttagagggtaaagtgcagcaataaccattgcttaaaaa |
40 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
54128884 |
tttagaggataaagtgcagcaataaccattgattaaaaa |
54128846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University