View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-59 (Length: 37)
Name: NF4306-Insertion-59
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-59 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.0000000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 47292701 - 47292665
Alignment:
| Q |
1 |
tcttggttccatttcaccttcgtcaatgcaccacatt |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47292701 |
tcttggttccatttcaccttcgtcaatgcaccacatt |
47292665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 47299308 - 47299272
Alignment:
| Q |
1 |
tcttggttccatttcaccttcgtcaatgcaccacatt |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47299308 |
tcttggttccatttcaccttcgtcaatgcaccacatt |
47299272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University