View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-65 (Length: 48)
Name: NF4306-Insertion-65
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-65 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 2e-19; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-19
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8262116 - 8262069
Alignment:
| Q |
1 |
acaacagatagatattatgtttagcaatgctgggattgcaagtccatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8262116 |
acaacagatagatattatgtttagcaatgctgggattgcaagtccatc |
8262069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8325108 - 8325061
Alignment:
| Q |
1 |
acaacagatagatattatgtttagcaatgctgggattgcaagtccatc |
48 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8325108 |
acaacaggtagatatcatgtttagcaatgctgggattgcaagtccatc |
8325061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 12 - 48
Target Start/End: Complemental strand, 8312356 - 8312320
Alignment:
| Q |
12 |
atattatgtttagcaatgctgggattgcaagtccatc |
48 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8312356 |
atattatgtttagcaatgttgggattgcaagtccatc |
8312320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University