View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-67 (Length: 68)
Name: NF4306-Insertion-67
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 9e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 9e-23
Query Start/End: Original strand, 4 - 65
Target Start/End: Complemental strand, 2090247 - 2090186
Alignment:
| Q |
4 |
aattcatatgctgctctggcatatgacccttcagaatcttggttctttaagattgtacattt |
65 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2090247 |
aattcatatgctgctctggtatatgacccttcagaatcttggttcttcaagattgtacattt |
2090186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 5 - 59
Target Start/End: Original strand, 2879091 - 2879145
Alignment:
| Q |
5 |
attcatatgctgctctggcatatgacccttcagaatcttggttctttaagattgt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
2879091 |
attcatatgctgctctggcatatgaccctgcagaatcttggtttttcaagattgt |
2879145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University