View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4306-Insertion-68 (Length: 136)

Name: NF4306-Insertion-68
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4306-Insertion-68
NF4306-Insertion-68
[»] chr4 (1 HSPs)
chr4 (4-136)||(54614136-54614268)


Alignment Details
Target: chr4 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 4 - 136
Target Start/End: Complemental strand, 54614268 - 54614136
Alignment:
4 accatgagcaacacaacaaccaccatctggaccggctcgaattgctgttccatcacccggtgcttgtccttgaacagaacaagacaatcttaacctatta 103  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54614268 accatgagcaacacaacagccaccatctggaccggctcgaattgctgttccatcacccggtgcttgtccttgaacagaacaagacaatcttaacctatta 54614169  T
104 ccatcaaattgaccccactttgcagaacgaaca 136  Q
    |||||||||||||||||||||||||||||||||    
54614168 ccatcaaattgaccccactttgcagaacgaaca 54614136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University