View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-68 (Length: 136)
Name: NF4306-Insertion-68
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-68 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 4 - 136
Target Start/End: Complemental strand, 54614268 - 54614136
Alignment:
| Q |
4 |
accatgagcaacacaacaaccaccatctggaccggctcgaattgctgttccatcacccggtgcttgtccttgaacagaacaagacaatcttaacctatta |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54614268 |
accatgagcaacacaacagccaccatctggaccggctcgaattgctgttccatcacccggtgcttgtccttgaacagaacaagacaatcttaacctatta |
54614169 |
T |
 |
| Q |
104 |
ccatcaaattgaccccactttgcagaacgaaca |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
54614168 |
ccatcaaattgaccccactttgcagaacgaaca |
54614136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University