View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-69 (Length: 164)
Name: NF4306-Insertion-69
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-69 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 7e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 7e-63
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 26465563 - 26465728
Alignment:
| Q |
1 |
gcttttacatgctttgtgcggctccacaagaggtaacctttttataactatcatgaaaaattt-gtaatatatgactatgggttaaacggataccaaacc |
99 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26465563 |
gcttttacatgctttgtgcagctccgcaagaggtaacctttttataaccatcatgaaaaaattagtaatatatgactaagggttaaacggataccaaacc |
26465662 |
T |
|
| Q |
100 |
ctggtgaaggagaaaatattaactgtt-aaatttgcttgatagaatgttaagaagtacaagttagg |
164 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26465663 |
ctggtgaaggagaaaatattaacggttaaaatttgcttgataggatgttaagaagtacaagttagg |
26465728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University