View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-71 (Length: 187)
Name: NF4306-Insertion-71
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-71 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 187
Target Start/End: Complemental strand, 32965710 - 32965535
Alignment:
| Q |
13 |
aattattaaacaagttaacctgagggatggccaagctagcaatggtgaggccagatataaggtcagctttaaggagtttgaaattgtaattaggtaacca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32965710 |
aattattaaacaagttaacctgagggatggccaagctagcaatggtgaggccagatataaggtcagctttaaggagtttgaaattgtaattaggtaacca |
32965611 |
T |
|
| Q |
113 |
ctgaagaataggaa-aaaatattgagctccaaggattaattttctgttacatggttgtcccttgaattgtcgcata |
187 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32965610 |
ctgaagaataggaaaaaaatattgagctccaaggattaattttctgttacatggttgtcccttgaattgtcgcata |
32965535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 94
Target Start/End: Complemental strand, 32954442 - 32954377
Alignment:
| Q |
29 |
aacctgagggatggccaagctagcaatggtgaggccagatataaggtcagctttaaggagtttgaa |
94 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||| ||||| | |||||||| ||||| ||||||||| |
|
|
| T |
32954442 |
aacctgtgggatggctaagctagcaatagtgagaccagaaacaaggtcagatttaaagagtttgaa |
32954377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University