View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-72 (Length: 244)
Name: NF4306-Insertion-72
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-72 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 6 - 218
Target Start/End: Complemental strand, 8801268 - 8801057
Alignment:
| Q |
6 |
attagattcagaacactgtcaacagatgaacaattggataaggtggggttgatcatgctcacaagtttaggcaaagttgtggggcttcttgtttctgaac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8801268 |
attagattcagaacactgtcaacagatgaacaattggataaggtggggttgatcatgctcacaagtttaggcaaagttgtggg-cttcttgtttctgaac |
8801170 |
T |
 |
| Q |
106 |
tagttgagggaccaagttggcatggaaaatccaccttttatattaagctcattatttaacatgctaaaacttacaaattgtaaactatttagggagcttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8801169 |
tagttgagggaccaagttggcatggaaaatccaccttttatattaagctcattatttaacatgctaaaacttacaaattgtaaactatttagggagcttt |
8801070 |
T |
 |
| Q |
206 |
tgaaaagtttcag |
218 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8801069 |
tgaaaagtttcag |
8801057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University