View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-73 (Length: 147)
Name: NF4306-Insertion-73
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 2e-41; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 6 - 99
Target Start/End: Complemental strand, 7095490 - 7095397
Alignment:
| Q |
6 |
tctttagcccttcatctttcttcttaagctttccttggtaacgtgggaaagaaggaaagttccatcgagtaggcttcttgcttttttgtacaag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
7095490 |
tctttagcccttcatctttcttcttaagctttccttggtaacgtgggaaagaaggaaagttccatcgagtaagcttcttgcttttttgcacaag |
7095397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 14 - 91
Target Start/End: Original strand, 6717648 - 6717725
Alignment:
| Q |
14 |
ccttcatctttcttcttaagctttccttggtaacgtgggaaagaaggaaagttccatcgagtaggcttcttgcttttt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||| ||||||||||| |||| ||||||| |||||| |
|
|
| T |
6717648 |
ccttcatctttcttcttaagctttccttggtaacctggaaaagaaagaaagttccataaagtaagcttcttacttttt |
6717725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 20 - 91
Target Start/End: Original strand, 6762491 - 6762562
Alignment:
| Q |
20 |
tctttcttcttaagctttccttggtaacgtgggaaagaaggaaagttccatcgagtaggcttcttgcttttt |
91 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| ||| || ||||||| | |||| |||||||||||||| |
|
|
| T |
6762491 |
tcttgcttcttaagctttccttggtaacctggaaaaaaataaaagttcttccaagtaagcttcttgcttttt |
6762562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University