View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-81 (Length: 183)
Name: NF4306-Insertion-81
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 29583822 - 29583691
Alignment:
| Q |
1 |
caaggttgcatgtgaatttatccgaggataacgtaaagtgttagaccggcaacatatagttttgttaaacgaaaaatgtgatttggcaatatttttaatc |
100 |
Q |
| |
|
||||||||| |||||||||||| ||||| | |||||| |||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
29583822 |
caaggttgcctgtgaatttatcggaggacagtgtaaagggttagaccagcaacatatagttttgttaaatgaaaaatgcgatttggcaatatttttaatc |
29583723 |
T |
 |
| Q |
101 |
tgcaagtacacaagttgtttgtaaaatatcag |
132 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| |
|
|
| T |
29583722 |
tgcaagtaaataagttgtttgtaaaatatcag |
29583691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University