View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-85 (Length: 173)
Name: NF4306-Insertion-85
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-85 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 6 - 122
Target Start/End: Original strand, 35207471 - 35207587
Alignment:
| Q |
6 |
ttaagaaaccaaaattcaccacttattattcagctcatgatggaaacgtctatttatttgataaaagaaaattttaatcatcaaattgtgtcttaattat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35207471 |
ttaagaaaccaaaattcaccacttattattcagctcatgatggaaacgtctatttatttgataaaagaaaattttaattatcaaattgtgtcttaattat |
35207570 |
T |
|
| Q |
106 |
catctattcatttattt |
122 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35207571 |
catctattcatttattt |
35207587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 126 - 173
Target Start/End: Original strand, 35207822 - 35207869
Alignment:
| Q |
126 |
tttgagggattgttttagaatttctattacgtgatgttaattttattg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35207822 |
tttgagggattgttttagaatttctattacgtgatgttaattttattg |
35207869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University