View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-88 (Length: 110)
Name: NF4306-Insertion-88
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-88 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 7e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 7e-31
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 11834948 - 11834838
Alignment:
| Q |
1 |
aaaagttatgcttaaacaatgtagacaatgtcagcattttctnnnnnnn--gttagtggtggattctatgcttaaaaagttgcggtcgattctatgtttt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11834948 |
aaaagttatgcttaaacaatgtagacaatgtcagcattttctaaaaaaaaagtt-gtggtggattctatgtttaaaaagttgcggtcgattctatgtttt |
11834850 |
T |
|
| Q |
99 |
ttgggtcaaacg |
110 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11834849 |
ttgggtcaaacg |
11834838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University