View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-92 (Length: 218)
Name: NF4306-Insertion-92
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-92 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 6 - 127
Target Start/End: Original strand, 16835057 - 16835178
Alignment:
| Q |
6 |
tacacatgtatttataagtactctcaagtatagaaacagaaagcgtaacttgtaggaataaatttttatatacgataaagtatagacgaagaaacaatca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
16835057 |
tacacatgtatttataagtactctcaagtatagaaacagaaagcgtagcttgtaggaataaatttatatatacgataaagtatcgacacagagacaatca |
16835156 |
T |
|
| Q |
106 |
ttgaatgccatactaacacgtg |
127 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
16835157 |
ttgaacaccatactaacacgtg |
16835178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 126 - 218
Target Start/End: Original strand, 16835230 - 16835322
Alignment:
| Q |
126 |
tgtgtcaatatcgtgttggtgtcttggtgaaatttaacaggcattcaacttgaagggtcggtgctacataattatatatacataccttcatgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| |||| ||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
16835230 |
tgtgtcaatatcgtgttggtgtcttgggcagattgaacacgcattcaacttgaagtgttggtgctacataattatatatacataccttcatgt |
16835322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University