View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306-Insertion-93 (Length: 68)
Name: NF4306-Insertion-93
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306-Insertion-93 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 47034772 - 47034836
Alignment:
| Q |
5 |
tatgtcacactccccagtgcataaaaacattaaagcgcgaaacatgtg-aaatcaaatataaccc |
68 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47034772 |
tatgtcacactcccgagtgcataaaaacattaaagcgcgaaacatgtgaaaatcaaatataaccc |
47034836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University