View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_high_26 (Length: 277)
Name: NF4306_high_26
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 268
Target Start/End: Complemental strand, 52243014 - 52242763
Alignment:
| Q |
17 |
agaatgagaggctgtggtgtgttcattttgatttcagttacaatatgtagacatttgatttatttagtatcacaaattattcacactttatccatattgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52243014 |
agaatgagaggctgtggtgtgttcattttgatttcagttacaatatgtagacatttgatttatttagtatcacaaattattcacactttatccatattgt |
52242915 |
T |
|
| Q |
117 |
attatgtggttttgcaatttctactagatttccattgccacctaactctgtcctcggtgacaattcaaattattatcatttcaaaattctcttcactgac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52242914 |
attatgtggttttgcaatttctactagatttccagtgccacctaactctgtccttggtgacaattcaaattattattatttcaaaattctcttcactgac |
52242815 |
T |
|
| Q |
217 |
atcattgttctttctcacaaacctctcagttcagttcagttctgttctgttc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242814 |
atcattgttctttctcacaaacctctcagttcagttcagttctgttctgttc |
52242763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University