View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_high_45 (Length: 234)
Name: NF4306_high_45
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_high_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 5 - 218
Target Start/End: Complemental strand, 30419606 - 30419393
Alignment:
| Q |
5 |
attttattttgtcagtccttatacaaatatattacttttgcttttgctccttgttttgttgttttagttcttccaactttgttcatattgaaactagtct |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30419606 |
atttttttttgtcagtccttatacaaatatattatttttgcttttgctccttgttttgttgttttagttcttctaactttgttcatattgaaactagtct |
30419507 |
T |
 |
| Q |
105 |
ttataagatgtgagtaaatttcaatacnnnnnnnnnnnnnnnnnnnnnnnnnttcacacaaagcggaggttaggggacgatgataggttacatcaatcat |
204 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30419506 |
ttataagatgtgagtaaatttcaatacgagagaggagaaagaagagagagagttcacacaaagcggaggttaggggacggtgataggttacatcaatcat |
30419407 |
T |
 |
| Q |
205 |
ctttctcatattac |
218 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30419406 |
ctttctcatattac |
30419393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University