View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_high_46 (Length: 229)
Name: NF4306_high_46
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 43367425 - 43367283
Alignment:
| Q |
1 |
attgacagatatggtgaattagata----aggattgtgtactaattgatgaaaataaaatcaacggataaaaaagagtctggtaatattactagatcaca |
96 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43367425 |
attgacagatatggtgaattagatagataaggattgtgtactaattgatgaaaataaaatcaacggataaaaaagagtctggtaatattactagatcaca |
43367326 |
T |
 |
| Q |
97 |
cctcaccgcnnnnnnnnnnnnttacggttacgacgttcttctgttcaaaag |
147 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43367325 |
cctcaccgc--------atatttacggttacgacgttcttctgttcaaaag |
43367283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 43367260 - 43367217
Alignment:
| Q |
173 |
cacacgcattatggaaattctaactacaacacatattcatctca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43367260 |
cacacgcattatggaaattctaactacaacacatattcatctca |
43367217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University