View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_high_49 (Length: 224)
Name: NF4306_high_49
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 46 - 197
Target Start/End: Complemental strand, 22689699 - 22689547
Alignment:
| Q |
46 |
aactaaatccacatgctattatgatcttcagcaaacacattatgaaccaggtgat-aaaaatagattacctttttgtcaaagcatctttcttttctcttt |
144 |
Q |
| |
|
|||||||| ||| || ||||||||||||| ||||||||||||||||| | || || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22689699 |
aactaaatacacgtgatattatgatcttccgcaaacacattatgaacaaagtaattaaaaatagattacctttttgtcaaagcatctttcttttctcttt |
22689600 |
T |
 |
| Q |
145 |
tgacgaaattttgtcaaggcagcctccctcaatgcaattcgttcttcatatga |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22689599 |
tgacgaaattttgtcaaggcagcctccctcaatgcaattcgttctgcatatga |
22689547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University