View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4306_high_49 (Length: 224)

Name: NF4306_high_49
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4306_high_49
NF4306_high_49
[»] chr4 (1 HSPs)
chr4 (46-197)||(22689547-22689699)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 46 - 197
Target Start/End: Complemental strand, 22689699 - 22689547
Alignment:
46 aactaaatccacatgctattatgatcttcagcaaacacattatgaaccaggtgat-aaaaatagattacctttttgtcaaagcatctttcttttctcttt 144  Q
    |||||||| ||| || ||||||||||||| ||||||||||||||||| | || || ||||||||||||||||||||||||||||||||||||||||||||    
22689699 aactaaatacacgtgatattatgatcttccgcaaacacattatgaacaaagtaattaaaaatagattacctttttgtcaaagcatctttcttttctcttt 22689600  T
145 tgacgaaattttgtcaaggcagcctccctcaatgcaattcgttcttcatatga 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||    
22689599 tgacgaaattttgtcaaggcagcctccctcaatgcaattcgttctgcatatga 22689547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University