View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_low_17 (Length: 372)
Name: NF4306_low_17
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 9 - 356
Target Start/End: Complemental strand, 37937054 - 37936707
Alignment:
| Q |
9 |
gacatcatcaccggcactggcattggtgcaatactcgctgcaatgatcacagctgatgatggatttggtagacctctctatactgctagagatgctgtga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37937054 |
gacatcatcaccggcactggcattggtgcaatactcgctgcaatgatcacagctgatgatggatttggtagacctctctatactgctagagatgctgtga |
37936955 |
T |
 |
| Q |
109 |
atttcattgctgacaggaatcatgaattctataaaatgaaatccgtcggtgttttccgccggcgccgtagattctcaacgaagagcattgaaaatttgtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936954 |
atttcattgctgacaggaatcatgaattctataaaatgaaatccgtcggtgttttccgccggcgccgtagattctcaacgaagagcattgaaaatttgtt |
37936855 |
T |
 |
| Q |
209 |
gaagcgagtttttcaaggaaaagaaagcgaaggtaaatctttgacgttgaaagatacgattaagcctttgcttattccttgctatgatctcaagacttca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37936854 |
gaagcgagtttttcaaggaaaagaaagcgaaggtaaatctttgacgttgaaagatacgattaagcctttgcttattccttgctatgatctcaacacttca |
37936755 |
T |
 |
| Q |
309 |
gcaccgttcgttttctcacgagccgatgcgtcggagtcaccgagtttc |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936754 |
gcaccgttcgttttctcacgagccgatgcgtcggagtcaccgagtttc |
37936707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 334
Target Start/End: Original strand, 32040121 - 32040179
Alignment:
| Q |
276 |
ttgcttattccttgctatgatctcaagacttcagcaccgttcgttttctcacgagccga |
334 |
Q |
| |
|
|||||||| ||||||| ||| ||||||| |||||| || |||||||| ||||||||||| |
|
|
| T |
32040121 |
ttgcttataccttgctttgacctcaagagttcagctccattcgttttttcacgagccga |
32040179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University