View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_low_19 (Length: 346)
Name: NF4306_low_19
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_low_19 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 212 - 346
Target Start/End: Original strand, 6470321 - 6470455
Alignment:
| Q |
212 |
atagacataatccactagcttgtttgcatccattgttcctgtcacagttactttccttgtgctaaactctgccactgctgtttgaactcctacattaatc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6470321 |
atagacataatccactagcttgtttgcatccattgttcctgtcacagttactttccttgtgctaaactctgccactgctgtttgaactcctacattaatc |
6470420 |
T |
|
| Q |
312 |
aatacaagtttttacattaattaataaaaataaat |
346 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
6470421 |
aatacaagtttttacattaattaatgcaaataaat |
6470455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 17 - 84
Target Start/End: Original strand, 6470126 - 6470193
Alignment:
| Q |
17 |
ttcttcatctgcaggtttttcactttcattctcttctggcttaacttcttctgctgcagctgtttcac |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
6470126 |
ttcttcatctgcaggtttttcactttcattctcttctggcttaacgtcttcttctgcagctgtttcac |
6470193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 6470172 - 6470222
Alignment:
| Q |
18 |
tcttcatctgcaggtttttcactttcattctcttctggcttaacttcttct |
68 |
Q |
| |
|
||||| ||||||| | |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
6470172 |
tcttcttctgcagctgtttcaccttcattctcttctggcttagcttcttct |
6470222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 212 - 346
Target Start/End: Complemental strand, 29282671 - 29282538
Alignment:
| Q |
212 |
atagacataatccactagcttgtttgcatccattgttcctgtcacagttactttccttgtgctaaactctgccactgctgtttgaactcctacattaatc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29282671 |
atagacataatccactagcttgtttgcatccattgttcctgtcacagttactttccctgtgctaaactctgtcactgctgtttgaactcctacattaatc |
29282572 |
T |
|
| Q |
312 |
aatacaagtttttacattaattaataaaaataaat |
346 |
Q |
| |
|
|||| | |||||||||||||||||| |||||||| |
|
|
| T |
29282571 |
aata-atgtttttacattaattaatgcaaataaat |
29282538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University