View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_low_30 (Length: 281)
Name: NF4306_low_30
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 263
Target Start/End: Original strand, 32724771 - 32725025
Alignment:
| Q |
14 |
tgagatgaaaaagcaacttaatttattattttgagtgttca-----tttcactagtgtatgttctatgtaatataggtctaggttttattgtatctagga |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724771 |
tgagatgaaaaagcaacttaatttattattttgagtgttcatttcatttcactagtgtatgttctatgtaatataggtctaggttttattgtatctagga |
32724870 |
T |
 |
| Q |
109 |
gcagctagtgaatttgtaacaattcaactaatgttgccagttttcaatctatttccatgttcaaattgatgagtattttttggacgtattactggtttat |
208 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32724871 |
gcagctgttgaatttgtaacaattgaactaatgttgccagttttcaatctatttccatgttcaaattgatgagtattttttgcacgtattactggtttat |
32724970 |
T |
 |
| Q |
209 |
gcggacagcatgattttcattagacacattgtcatttgttttgaggattgatact |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724971 |
gcggacagcatgattttcattagacacattgtcatttgttttgaggattgatact |
32725025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University