View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_low_37 (Length: 255)
Name: NF4306_low_37
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_low_37 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 10 - 255
Target Start/End: Complemental strand, 14240091 - 14239847
Alignment:
| Q |
10 |
ataatactccatattctgtaagtatatgcatgttgccatcttaatttatgttatttgatatatgcattgctaattaccaactctctccaaaaggatcata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14240091 |
ataatactccatattctgtaagtatatgcacgttgccatcttaatttatgttatttgatatacgcattgctaattaccaactctctccaaaaggatcata |
14239992 |
T |
|
| Q |
110 |
aatgattttatatgaagcagtagcacaccttttcatgaaccattcatttttctaaataataaaagaaccatcaattaaaggggattagtagtgtagcttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14239991 |
aatgattttatatgaagcagtagcacaccttttcatgaaccattca-ttttctaaataataaaagaaccatcaattaaaggggattagtagtgtagcttt |
14239893 |
T |
|
| Q |
210 |
atcaattgagcacacttttagacagataacatattcattagctctc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14239892 |
atcaattgagcacacttttagacagataacatattcattagctctc |
14239847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University