View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_low_38 (Length: 255)
Name: NF4306_low_38
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 42680050 - 42679843
Alignment:
| Q |
1 |
caagcttctcctgcattgacaccaagcaataaaactcttcggagttt----------gtgtactgtgagagaagtcgtagcaaggaggcgaaattcttgt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42680050 |
caagcttctcctgcattgacaccaagcaataaaactctttggagttttcgatcatcggtgtactgtgagagaagtcgtagcaaggaggcgaaattcttgt |
42679951 |
T |
|
| Q |
91 |
ccaagaagccggaggcaaggtagttttctgattcaaagatgtttcttggaaagcataaattagtaatacggtaaaccaccagtttgtaaggtgaaccatg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42679950 |
ccaagaagccggaggcaaggtagttttctgattcaaagatgtttcttggaaagcataaattagtaatacggtaaaccaccggtttgtaaggtgaaccatg |
42679851 |
T |
|
| Q |
191 |
tcactcac |
198 |
Q |
| |
|
|||||||| |
|
|
| T |
42679850 |
tcactcac |
42679843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University