View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4306_low_42 (Length: 246)
Name: NF4306_low_42
Description: NF4306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4306_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 33443420 - 33443205
Alignment:
| Q |
19 |
cttctatggctttattgttctcctgaattttagcctccgaaactcgtaaatattcaagttccgaaataagagcatttgcccaggatccagaagagatagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33443420 |
cttctatggctttattgttctcctgaattttagcctccgaaactcgtaaatattcaagttccgaaataagagcatttgcccaggatccagaagagatagc |
33443321 |
T |
 |
| Q |
119 |
ctcatcatcactagaaatgtcaaaatttgacattgaaggaagttcatttgatgtaggataacaccttgctagttccatggacttgtaattttcagaaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33443320 |
ctcatcatcactagaaatgtcaaaatttgacattgaaggaagttcatttgatgtaggataacaccttgctagttccatggacttgtaattttcagaaaat |
33443221 |
T |
 |
| Q |
219 |
tttctaagaataatct |
234 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
33443220 |
tttctaagaagaatct |
33443205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University